Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU048411

Sigma-Aldrich

MISSION® esiRNA

targeting human WRN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCCACGGAGGGTTTCTATCTTACTAAAGGATATTTCAGAAAATCTATATTCACTGAGGAGGATGATAATTGGGTCTACTAACATTGAGACTGAACTGAGGCCCAGCAATAATTTAAACTTATTATCCTTTGAAGATTCAACTACTGGGGGAGTACAACAGAAACAAATTAGAGAACATGAAGTTTTAATTCACGTTGAAGATGAAACATGGGACCCAACACTTGATCATTTAGCTAAACATGATGGAGAAGATGTACTTGGAAATAAAGTGGAACGAAAAGAAGATGGATTTGAAGATGGAGTAGAAGACAACAAATTGAAAGAGAATATGGAAAGAGCTTGTTTGATGTCGTTAGATATTACAGAACATGAACTCCAAATTTTGGAACAGCAGTCTCAGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jyotirindra Maity et al.
DNA repair, 68, 1-11 (2018-05-26)
Impaired autophagy may be associated with normal and pathological aging. Here we explore a link between autophagy and domain function of Werner protein (WRNp). Werner (WRN) mutant cell lines AG11395, AG05229 and normal aged fibroblast AG13129 display a deficient response
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Edmond M Chan et al.
Nature, 568(7753), 551-556 (2019-04-12)
Synthetic lethality-an interaction between two genetic events through which the co-occurrence of these two genetic events leads to cell death, but each event alone does not-can be exploited for cancer therapeutics1. DNA repair processes represent attractive synthetic lethal targets, because
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico