Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU048061

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCTGCAAGAACCAAGTGCTGCTGGGCCGGAGCAGCCCCTCCAAGAACTACGTGATGGCAGTCTCCAGCTAGGCCCTTCCGCCCCCGCCCTGGGCGCCGCCGTGCTCATGCTGCCGTGACAACAGGCCACCACATACCTCAACCTGGGGAACTGTATTTTTAAATGAAGAGCTATTTATATATATTATTTTTTTTTAAGAAAGGAGGAAAAGAAACCAAAAGTTTTTTTTAAGAAAAAAAATCCTTCAAGGGAGCTGCTTGGAAGTGGCCTCCCCAGGTGCCTTTGGAGAGAACTGTTGCGTGCTTGAGTCTGTGAGCCAGTGTCTGCCTATAGGAGGGGGAGCTGTTAGGGGGTAGACCTAGCCAAGGAGAAGTGGGAGACGTTTGGCTAGCACCCCAGGAAGATGTGAGAGGGAGCAAGCAAGGTTAGCAACTGTGAACAGAGAGGTCGGGATT

Ensembl | nº de acceso humano

ENSG00000159388

Nº de acceso NCBI

NM_006763

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BTG2(7832) , BTG2(7832)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hua Chen et al.
Molecular cancer, 17(1), 4-4 (2018-01-10)
Triple-negative breast cancer (TNBC) is highly invasive and aggressive and lacks specific molecular targets to improve the prognosis. MiR-25-3p promotes proliferation of many tumors and its role and underlying mechanisms in TNBC remain to be well elucidated. Differential expression of
Peihe Wang et al.
Oncology research, 25(7), 1199-1205 (2017-03-03)
Gamma ray can promote cancer cell apoptosis and cell cycle arrest. It is often used in the clinical treatment of tumors, including lung cancer. In this study, we aimed to explore the role of gamma ray treatment and its correlation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico