Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU047911

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCB10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTGACAAGACTCGCACAGGAGAATTGATTAACCGCCTCTCATCAGACACTGCACTCCTGGGGCGCTCAGTGACTGAAAACCTCTCAGATGGGCTCAGGGCCGGGGCCCAGGCTTCCGTAGGCATCAGTATGATGTTTTTTGTCTCACCTAATCTGGCCACCTTTGTTTTGAGCGTGGTGCCTCCAGTGTCAATCATTGCTGTAATTTATGGGCGATATCTACGGAAACTGACCAAAGTCACTCAGGATTCCCTGGCACAAGCCACTCAGCTAGCTGAGGAACGTATTGGAAATGTAAGAACTGTTCGAGCTTTTGGGAAAGAAATGACTGAAATCGAGAAATATGCCAGCAAAGTGGACCATGTAATGCAGTTAGCAAGGAAAGAGGCATTCGCCCGGGCTGGTTTCTTTGGAGCAACTGGGCTCTCCGGAAACCTGATCGTGCTTTCTGTCCTG

Ensembl | nº de acceso humano

ENSG00000135776

Nº de acceso NCBI

NM_012089

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ABCB10(23456) , ABCB10(23456)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

W-Q Zhang et al.
European review for medical and pharmacological sciences, 24(11), 6088-6096 (2020-06-24)
Circ-ABCB10 is a non-coding RNA newly discovered in recent years. It has been observed to serve as an oncogene in a variety of tumors, but its biological function in esophageal squamous cell carcinoma (ESCC) is still unknown. The purpose of
Xuefang Lin et al.
Molecular medicine reports, 23(5) (2021-03-25)
Circular RNA ABCB10 (circ‑ABCB10) modulates cellular functions and microRNA (miR)‑1271 in epithelial ovarian cancer (EOC). The present study aimed to investigate the interaction between circ‑ABCB10 and miR‑1271 in regulating EOC cellular function and the calpain small subunit 1 (Capn4)/Wnt/β‑catenin signaling pathway.
Yan Chen et al.
Cancer biomarkers : section A of Disease markers, 26(2), 151-161 (2019-08-06)
This study aimed to explore the correlation of circular RNA ABCB10 (circ-ABCB10) expression with clinicopathological features and survival, as well as its impact on regulating cell proliferation and apoptosis in epithelial ovarian cancer (EOC). A total of 103 EOC patients

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico