Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU047891

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAGCGTTTCCAAGTCCTGAACCCCACCTGGAGTGCTGAGGCCCATGGCCTGGCTCCTGATGGTGACGTCTTTCTCTCAGAGGAGCAAGTCCGGAGCTTTCAGGTCCCAACCTGCGTTCAATGTGGAGGCCATCTGAAACCAGATGTCGTTTTCTTCGGGGACACAGTGAACCCTGACAAGGTTGATTTTGTGCACAAGCGTGTAAAAGAAGCCGACTCCCTCTTGGTGGTGGGATCATCCTTGCAGGTATACTCTGGTTACAGGTTTATCCTCACTGCCTGGGAGAAGAAGCTCCCGATTGCAATACTGAACATTGGGCCCACACGGTCGGATGACTTGGCGTGTCTGAAACTGAATTCTCGTTGTGGAGAGTTGCTGCCTTTGATAGACCCATGCTGACCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongjie Sun et al.
OncoTargets and therapy, 11, 3959-3968 (2018-07-20)
Previous study has proven that SIRT4 is downregulated in gastric cancer (GC), but the role of SIRT4 has not been clearly understood. The aim of our work was to explore in detail the function and mechanism of SIRT4 in GC.
Ratana Lim et al.
Biology of reproduction, 95(5), 95-95 (2016-11-05)
Preterm birth remains the major cause of neonatal mortality and morbidity, mediated largely by an inflammatory process. The sirtuin (SIRT) family of cellular regulators has been implicated as key inhibitors of inflammation. We have previously reported a role for SIRT1
Peixin Huang et al.
Oncotarget, 6(13), 10812-10824 (2015-05-01)
Aging is the predominant risk factor for cardiovascular diseases and contributes to a considerably more severe outcome in patients with acute myocardial infarction. Resveratrol, a polyphenol found in red wine, is a caloric restriction mimetic with potential anti-aging properties which

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico