Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU047541

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK5R1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGACATGCCTGTACCTCTCCTACTCCTACATGGGCAACGAGATCTCCTACCCGCTCAAGCCCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGTTGCCTCTCTGTCATCAACCTCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACACAGGTCTTCTCCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTAGGCCTGGATCGGTGAGCACTGTAGCCTGCGTCATGGCTCAAGGATTCAATGCATTTTTAAGAATTTATTATTAAATCAGTTTTGTGTACAGTATGTGTCTAGCAAAGCCACCAAGGGCCTCACCTTTCCCACAGTCTCTCCCTGGGGTTTTTTTCATCCCTGCCAAGAAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tianmei Qian et al.
Molecular and cellular biochemistry, 447(1-2), 209-215 (2018-02-02)
The proliferation and migration of Schwann cells are critical for the repair and regeneration of injured peripheral nerves. Noncoding RNAs, especially microRNAs (miRNAs), have been demonstrated to participate in regulating the biological behaviors of Schwann cells. Numerous differentially expressed novel
Silvia Moncini et al.
PloS one, 6(5), e20038-e20038 (2011-06-01)
CDK5R1 encodes p35, a specific activator of the serine/threonine kinase CDK5, which plays crucial roles in CNS development and maintenance. CDK5 activity strongly depends on p35 levels and p35/CDK5 misregulation is deleterious for correct CNS function, suggesting that a tightly

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico