Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU047031

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACAATTCATGGAGCCAGGTTATCCCAAAAGCATATCAGGTGCCTTTCCAGGAATAGAGAGTAAAGTTGATGCAGTTTTCCAGCAAGAACATTTCTTCCATGTCTTCAGTGGACCAAGATATTACGCATTTGATCTTATTGCTCAGAGAGTTACCAGAGTTGCAAGAGGCAATAAATGGCTTAACTGTAGATATGGCTGAAGCAAAATCAAATGTGGCTGTATCCACTTTCAGAATGTTGAAGGGAAGTTCAGCAAGCATTTTCGTTACATTGTGTCCTGCTTATACTTTTCTCAATATTAAGTCATTGTTTCCCATCACTGTATCCATTCTACCTGTCCTCCGTGAAAATATGTTTGGAATATTCCACTATTTGCAGAGGCTTATTCAGTTCTTACACATTCCATCTTACATTAGTGATTCCATCAAAGAGAAGGAAAGTAAGCCTTTTTGTCACC

Ensembl | nº de acceso humano

ENSG00000118113

Nº de acceso NCBI

NM_002424

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP8(4317) , MMP8(4317)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alexandra Schubert-Unkmeir et al.
PLoS pathogens, 6(4), e1000874-e1000874 (2010-05-06)
Disruption of the blood-brain barrier (BBB) is a hallmark event in the pathophysiology of bacterial meningitis. Several inflammatory mediators, such as tumor necrosis factor alpha (TNF-alpha), nitric oxide and matrix metalloproteinases (MMPs), contribute to this disruption. Here we show that
Guanmei Wen et al.
The Journal of biological chemistry, 290(31), 19158-19172 (2015-06-21)
Matrix metalloproteinase-8 (MMP8) has been shown to influence various cellular functions. As monocytes and macrophages (Mφ) express MMP8, we investigated if MMP8 played a role in macrophage differentiation and polarization. MMP8 expression was significantly increased during monocyte differentiation into Mφ.
Muge Sarper et al.
Breast cancer research : BCR, 19(1), 33-33 (2017-03-24)
Normal myoepithelial cells (MECs) play an important tumour-suppressor role in the breast but display an altered phenotype in ductal carcinoma in situ (DCIS), gaining tumour-promoter functions. Matrix metalloproteinase-8 (MMP-8) is expressed by normal MECs but is lost in DCIS. This

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico