Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU046781

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC5L

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGTAACTCCACAGCGACAAGTTGTACAGACTCCAAACACAGTTCTCTCTACTCCATTCAGGACTCCTTCTAATGGAGCTGAAGGGCTGACTCCCCGGAGTGGAACAACTCCCAAACCAGTTATTAACTCTACTCCGGGTAGAACTCCTCTTCGAGACAAGTTAAACATTAATCCCGAGGATGGAATGGCAGACTATAGTGATCCCTCTTACGTGAAGCAGATGGAAAGAGAATCCCGAGAACATCTCCGTTTAGGGTTGTTGGGCCTTCCTGCCCCTAAGAATGATTTTGAAATTGTTCTACCAGAAAATGCCGAGAAGGAGCTGGAAGAACGTGAAATAGATGATACTTACATTGAAGATGCTGCTGATGTGGATGCTCGAAAGCAGGCCATACGAGATGCAGAGCGTGTAAAGGAAATGAAACGAATGCATAAAGCTGTCCAGAAAGATCTGCC

Ensembl | nº de acceso humano

ENSG00000096401

Nº de acceso NCBI

NM_001253

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CDC5L(988) , CDC5L(988)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jia Li et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2475-2488 (2017-05-05)
Colorectal cancer (CRC) is the third leading cause of cancer-related death worldwide because the survival rate remains low. Cell division cycle 5-like (CDC5L) is highly expressed in some cancer cells, but the mechanism requires clarification. Human telomerase reverse transcriptase (hTERT)
Ziwei Zhang et al.
Journal of Cancer, 11(2), 353-363 (2020-01-04)
Cell division cycle 5-like (CDC5L) protein is a cell cycle regulator of the G2/M transition and has been reported to participate in the catalytic step of pre-messenger RNA (mRNA) splicing and DNA damage repair. Recently, CDC5L was also found to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico