Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU046261

Sigma-Aldrich

MISSION® esiRNA

targeting human SETDB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAGGCAGTGGTTGAGGAACTGGGTATCTCTATGGAGGAACTTCGGCATTTCATCGATGAGGAACTGGAGAAGATGGATTGTGTACAGCAACGCAAGAAGCAGCTAGCAGAGTTAGAGACATGGGTAATACAGAAAGAATCTGAGGTGGCTCACGTTGACCAACTCTTTGATGATGCATCCAGGGCAGTGACTAATTGTGAGTCTTTGGTGAAGGACTTCTACTCCAAGCTGGGACTACAATACCGGGACAGTAGCTCTGAGGACGAATCTTCCCGGCCTACAGAAATAATTGAGATTCCTGATGAAGATGATGATGTCCTCAGTATTGATTCAGGTGATGCTGGGAGCAGAACTCCAAAAGACCAGAAGCTCCGTGAAGCTATGGCTGCCTTAAGAAAGTCAGCTCAAGATGTTCAGAAGTTCATGGATGCTGTCAACAAGAAGAGCAGTTCCCAGG

Ensembl | nº de acceso humano

ENSG00000143379

Nº de acceso NCBI

NM_012432

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SETDB1(9869) , SETDB1(9869)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yingjie Shao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 355-364 (2018-12-07)
Radiotherapy is one of the most important treatment methods of tumors. However, the application of radiotherapy in hepatocellular carcinoma (HCC) is limited due to the low tolerance of normal liver cells for radiation and inherent radiation resistance in HCC. With the
Sibel Özdaş
Turkish journal of biology = Turk biyoloji dergisi, 43(5), 281-292 (2019-11-27)
Head and neck cancer (HNC) is the sixth most common cancer worldwide and therefore presents a global public health problem. There are no standard algorithms for the diagnosis and follow-up of the disease, and no effective current treatment approaches exist.
Young Joon Song et al.
Molecules and cells, 38(4), 362-372 (2015-02-27)
Setdb1, an H3-K9 specific histone methyltransferase, is associated with transcriptional silencing of euchromatic genes through chromatin modification. Functions of Setdb1 during development have been extensively studied in embryonic and mesenchymal stem cells as well as neurogenic progenitor cells. But the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico