Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU046081

Sigma-Aldrich

MISSION® esiRNA

targeting human FAT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AATTGCTGACAACGCCTCTCCGAAGTTTACATCAAAAGAATATTCTGTTGAACTTAGTGAAACTGTCAGCATTGGGAGTTTCGTTGGGATGGTTACAGCCCATAGTCAATCATCAGTGGTGTATGAAATAAAAGATGGAAATACAGGTGATGCTTTTGATATTAATCCACATTCTGGAACTATCATCACTCAGAAAGCCCTGGACTTTGAAACTTTGCCCATTTACACATTGATAATACAAGGAACTAACATGGCTGGTTTGTCCACTAATACAACGGTTCTAGTTCACTTGCAGGATGAGAATGACAACGCGCCAGTTTTTATGCAGGCAGAATATACAGGACTCATTAGTGAATCAGCCTCAATTAACAGCGTGGTCCTAACAGACAGGAATGTCCCACTGG

Ensembl | nº de acceso humano

ENSG00000083857

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FAT1(2195) , FAT1(2195)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xinhui Wu et al.
Cell biology international, 41(1), 24-32 (2016-10-21)
Porcine cumulus cells are localized around oocytes and act as a specific type of granulosa that plays essential roles in the development and maturation of oocytes, the development and atresia of follicles, and the development of embryos. Studies of FAT1
Evanka Madan et al.
International journal of cancer, 139(11), 2570-2582 (2016-08-19)
The hypoxic microenvironment is an important contributor of glioblastoma (GBM) aggressiveness via HIF1α, while tumour inflammation is profoundly influenced by FAT Atypical Cadherin (FAT1). This study was designed to explore the functional interaction and significance of FAT1 and HIF1α under
Andrey Sheyko et al.
Nature, 539(7630), 551-554 (2016-11-08)
A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a
Tung-Nien Hsu et al.
Cancers, 11(12) (2019-12-01)
FAT atypical cadherin 1 (FAT1) regulates cell-cell adhesion and extracellular matrix architecture, while acting as tumor suppressor or oncogene, context-dependently. Despite implication of FAT1 in several malignancies, its role in oral squamous cell carcinoma (OSCC) remains unclear. Herein, we document
Longyue L Cao et al.
Nature, 539(7630), 575-578 (2016-11-10)
Mitochondrial products such as ATP, reactive oxygen species, and aspartate are key regulators of cellular metabolism and growth. Abnormal mitochondrial function compromises integrated growth-related processes such as development and tissue repair, as well as homeostatic mechanisms that counteract ageing and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico