Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU044071

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP8AP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGTTCATCCTGATGTGTTGGATGAAAGTTGTATGTTTGAAGTGTCTACTAACCTACCTTTAAGTAAAGATAATGTGTGTAGTGTAGAAAAGAGCAAGCCCTGCGTTTCTTCCATACTTCTTGAAGATCTAGCAGTCTCTTTAACAGTACCATCGCCTCTGAAGTCAGATGGTCATCTCAGTTTTTTAAAGCCTGATATGTCGTCCAGTTCAACTCCTGAAGAAGTCATTAGTGCTCATTTTAGTGAAGATGCCTTACTTGAGGAAGAGGATGCATCTGAGCAAGATATTCATTTAGCTCTGGAGTCTGATAATTCAAGCAGTAAATCAAGTTGTTCTTCTTCCTGGACAAGCCGATCTGTTGCTCCAGGCTTTCAGTACCACCCTAATCTACCTATGCATGCCGTCATAATGGAAAAGTCCAATGATCATTTCATTGTGAAAATACGACGTGCAACACCA

Ensembl | nº de acceso humano

ENSG00000118412

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CASP8AP2(9994) , CASP8AP2(9994)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Takahiro Hirano et al.
PloS one, 10(7), e0133205-e0133205 (2015-07-25)
Dysregulation of the cell proliferation has been implicated in the pathophysiology of a number of diseases. Cellular senescence limits proliferation of cancer cells, preventing tumorigenesis and restricting tissue damage. However, the role of cellular senescence in proliferative nephritis has not

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico