Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU043791

Sigma-Aldrich

MISSION® esiRNA

targeting human NUAK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAAGATCGTGATCGTCATGGAGTATGCCAGCCGGGGCGACCTTTATGACTACATCAGCGAGCGGCAGCAGCTCAGTGAGCGCGAAGCTAGGCATTTCTTCCGGCAGATCGTCTCTGCCGTGCACTATTGCCATCAGAACAGAGTTGTCCACCGAGATCTCAAGCTGGAGAACATCCTCTTGGATGCCAATGGGAATATCAAGATTGCTGACTTCGGTCTCTCCAACCTCTACCATCAAGGCAAGTTCCTGCAGACATTCTGTGGGAGCCCCCTCTATGCCTCGCCAGAGATTGTCAATGGGAAGCCCTACACAGGCCCAGAGGTGGACAGCTGGTCCCTGGGTGTTCTCCTCTACATCCTGGTGCATGGCACCATGCCCTTTGATGGGCATGACCATAAGATCCTAGTGAAACAGATCAGCAACGGGGCCTACCGGGAGCCACCTAAACCCTCTGATGCCTG

Ensembl | nº de acceso humano

ENSG00000163545

Nº de acceso NCBI

NM_030952

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NUAK2(81788) , NUAK2(81788)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Devon E Mason et al.
The Journal of cell biology, 218(4), 1369-1389 (2019-02-10)
Cell migration initiates by traction generation through reciprocal actomyosin tension and focal adhesion reinforcement, but continued motility requires adaptive cytoskeletal remodeling and adhesion release. Here, we asked whether de novo gene expression contributes to this cytoskeletal feedback. We found that
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Mandeep K Gill et al.
Nature communications, 9(1), 3510-3510 (2018-08-31)
In most solid tumors, the Hippo pathway is inactivated through poorly understood mechanisms that result in the activation of the transcriptional regulators, YAP and TAZ. Here, we identify NUAK2 as a YAP/TAZ activator that directly inhibits LATS-mediated phosphorylation of YAP/TAZ

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico