Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU042991

Sigma-Aldrich

MISSION® esiRNA

targeting human TERF2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGCCCTCAAAAACAAGAGACCCAGAAAAGATGAAAACGAAAGTTCAGCCCCGGCTGACGGTGAGGGTGGCTCGGAACTGCAGCCCAAGAACAAGCGCATGACAATAAGCAGATTGGTCTTGGAGGAGGACAGCCAGAGTACTGAGCCCAGCGCAGGCCTCAACTCCTCCCAGGAGGCCGCTTCAGCGCCACCATCCAAGCCCACCGTTCTCAACCAACCCCTCCCTGGAGAGAAGAATCCCAAAGTACCCAAAGGCAAGTGGAACAGCTCTAATGGGGTTGAAGAAAAGGAGACTTGGGTGGAAGAGGATGAACTGTTTCAAGTTCAGGCAGCACCAGATGAAGACAGTACAACCAATATAACAAAAAAGCAGAAGTGGACTGTAGAAGAAAGCGAGTGGGTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1
Deeksha Pal et al.
PloS one, 10(3), e0115651-e0115651 (2015-03-03)
Telomere binding factors viz. TRF1 and TRF2 are a part of sheltrin complex that are present exclusively at the ends of chromosomes. These factors play an important role in maintaining chromosomal integrity at the ends. However, their status and role

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico