Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU042681

Sigma-Aldrich

MISSION® esiRNA

targeting human IREB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGCTTGCTGCAGGTCTTTTGGCTAAAAAGGCTGTTGAAGCTGGTCTGCGTGTTAAACCTTATATAAGAACAAGTTTATCTCCAGGCAGTGGGATGGTTACACATTACCTCAGTTCAAGTGGAGTATTACCATATCTAAGTAAGCTTGGATTTGAAATCGTTGGCTATGGATGTTCAATTTGTGTGGGAAATACAGCACCCTTATCAGACGCAGTTTTAAATGCAGTAAAACAGGGTGATTTGGTTACCTGTGGAATTTTATCTGGAAACAAAAATTTTGAAGGTCGTCTTTGTGATTGTGTTCGTGCCAATTATCTTGCCTCTCCACCCTTAGTGGTAGCTTATGCCATAGCAGGCACAGTGAATATAGATTTCCAGACAGAACCTTTAGGTACTGACCCCACCG

Ensembl | nº de acceso humano

ENSG00000136381

Nº de acceso NCBI

NM_004136

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IREB2(3658) , IREB2(3658)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fei Liu et al.
Cancer management and research, 11, 10891-10900 (2020-01-11)
Clear cell renal cell carcinoma (ccRCC) has the highest rate of metastasis and invasion in RCC and is the third most common adult urinary malignancy. miRNA may serve a critical role in human cancer development and progression, has been confirmed
Jin Zhang et al.
The Journal of pathology, 251(3), 284-296 (2020-04-19)
Ferredoxin reductase (FDXR) is a mitochondrial flavoprotein that initiates electron transport from NADPH to several cytochromes P450 via two electron carriers, ferredoxin 1 (FDX1) and FDX2. FDXR is the sole ferredoxin reductase in humans and plays a critical role in
Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Toshifumi Hoki et al.
Hepatology (Baltimore, Md.), 62(3), 751-761 (2015-03-11)
Increased hepatic iron accumulation is thought to be involved in the pathogenesis of nonalcoholic steatohepatitis (NASH). Hepatic iron accumulation, as well as oxidative DNA damage, is significantly increased in NASH livers. However, the precise mechanism of iron accumulation in the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico