Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU042151

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGGTTCAAGTGGTGGGATTACAGGAACGGGAGGTCAAATGTGTTGAAGATGTACTGAAACTCATTGACATAGGCAACAGTTGCAGAACATCCGGTCAAACATCTGCAAATGCACATTCATCTCGGAGCCATGCAGTGTTTCAGATTATTCTTAGAAGGAAAGGAAAACTACATGGCAAATTTTCTCTCATTGATTTGGCTGGAAATGAAAGAGGAGCTGATACTTCCAGTGCGGACAGGCAAACTAGGCTTGAAGGTGCTGAAATTAATAAAAGCCTTTTAGCACTCAAGGAGTGCATCAGAGCCTTAGGTAGAAATAAACCTCATACTCCTTTCCGTGCAAGTAAACTCACTCAGGTGTTAAGAGATTCTTTCATAGGTGAAAACTCTCGTACCTGCATGATTGC

Ensembl | nº de acceso humano

ENSG00000068796

Nº de acceso NCBI

NM_004520

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KIF2A(3796) , KIF2A(3796)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming-Huang Chen et al.
Scientific reports, 6, 39337-39337 (2016-12-20)
KIF2A, a member of the kinesin-13 family, has been reported to play a role in spindle assembly in mitosis. However, its function in mammalian meiosis remains unknown. In this research, we examined the expression, localization and function of KIF2A during
Baobiao Zhuo et al.
Biochemical and biophysical research communications, 464(2), 401-406 (2015-06-28)
Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico