Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU041881

Sigma-Aldrich

MISSION® esiRNA

targeting human SNCG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACACCCACCATGGATGTCTTCAAGAAGGGCTTCTCCATCGCCAAGGAGGGCGTGGTGGGTGCGGTGGAAAAGACCAAGCAGGGGGTGACGGAAGCAGCTGAGAAGACCAAGGAGGGGGTCATGTATGTGGGAGCCAAGACCAAGGAGAATGTTGTACAGAGCGTGACCTCAGTGGCCGAGAAGACCAAGGAGCAGGCCAACGCCGTGAGCGAGGCTGTGGTGAGCAGCGTCAACACTGTGGCCACCAAGACCGTGGAGGAGGCGGAGAACATCGCGGTCACCTCCGGGGTGGTGCGCAAGGAGGACTTGAGGCCATCTGCCCCCCAACAGGAGGGTGAGGCATCCAAAGAGAAAGAGGAAGTGGCAGAGGAGGCCCAGAGTGGGGGAGACTAGAGGGCTACAGGCCA

Ensembl | nº de acceso humano

ENSG00000173267

Nº de acceso NCBI

NM_003087

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SNCG(6623) , SNCG(6623)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Changru Fan et al.
Cytogenetic and genome research, 154(4), 209-216 (2018-06-15)
The aim of the study was to evaluate the effects of synuclein-γ (SNCG) silencing on gastric cancer SGC7901 cells and to elucidate the associated mechanisms. pGCSIL-lentiviral siRNA targeting of the SNCG gene was employed to inhibit SNCG expression. Several experiments
Jingsong He et al.
Journal of breast cancer, 17(3), 200-206 (2014-10-17)
Synuclein-γ (SNCG), which was initially identified as breast cancer specific gene 1, is highly expressed in advanced breast cancers, but not in normal or benign breast tissue. This study aimed to evaluate the effects of SNCG siRNA-treatment on breast cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico