Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU041771

Sigma-Aldrich

MISSION® esiRNA

targeting human TAX1BP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTTCGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATGTTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAAAAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAACAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAAGCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTTAAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCAGTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAGAAGGCACA

Ensembl | nº de acceso humano

ENSG00000106052

Nº de acceso NCBI

NM_006024

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TAX1BP1(8887) , TAX1BP1(8887)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hoyun Choi et al.
Archives of virology, 162(2), 369-377 (2016-10-21)
MicroRNAs (miRNAs) are a class of noncoding RNA molecules approximately 19 to 25 nucleotides in length that downregulate the expression of target genes at the post-transcriptional level by binding to the 3'-untranslated region (3'-UTR). Epstein-Barr virus (EBV) generates at least
Zhipeng Li et al.
Free radical biology & medicine, 153, 132-139 (2020-04-21)
Isobavachalcone (IBC) is a natural compound isolated from Fructus psoraleae. In recent years, IBC has been reported to exert anti-neuroinflammatory effect, but precise mechanisms of action remain unclear. The current study is focused on elucidating the underlying molecular mechanisms. Toward

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico