Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU040951

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSD, RP11-295K3.1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAA

Ensembl | nº de acceso humano

ENSG00000117984

Nº de acceso NCBI

NM_001909

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CTSD(1509) , CTSD(1509)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tung-Yi Lin et al.
International journal of molecular sciences, 21(17) (2020-08-28)
Poor prognosis due to the high relapse and metastasis rates of breast cancer has been particularly linked to the luminal B subtype. The current study utilized MCF-7 and ZR-75-1 to investigate various luminal subtypes of breast cancers that have discrepant
Satoshi Kitazawa et al.
Cancer science, 108(6), 1185-1193 (2017-03-21)
Vacuolar (H
C S F Oliveira et al.
Cell death & disease, 6, e1788-e1788 (2015-06-19)
Acetate is a short-chain fatty acid secreted by Propionibacteria from the human intestine, known to induce mitochondrial apoptotic death in colorectal cancer (CRC) cells. We previously established that acetate also induces lysosome membrane permeabilization in CRC cells, associated with release
Lin Cui et al.
Frontiers in cell and developmental biology, 8, 31-31 (2020-03-03)
Lysosomal membrane permeabilization (LMP) has recently been recognized as an important cell death pathway in various cell types. However, studies regarding the correlation between LMP and cardiomyocyte death are scarce. Lysosomal membrane-associated protein 2 (Lamp2) is an important component of
Morten P Oksvold et al.
Clinical therapeutics, 36(6), 847-862 (2014-06-24)
Exosomes are small (30- to 100-nm) vesicles secreted by all cell types in culture and found in most body fluids. A mean of 1 mL of blood serum, derived from healthy donors, contains approximately 10(12) exosomes. Depending on the disease
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico