Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU039451

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXL7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCTGGATGTGTCAGGATGCTCCAAAGTGACCTGCATCAGCTTGACCCGGGAGGCCTCCATTAAACTGTCACCCTTGCATGGCAAACAGATTTCCATCCGCTACCTGGACATGACGGACTGCTTCGTGCTGGAGGACGAAGGCCTGCACACCATCGCGGCGCACTGCACGCAGCTCACCCACCTCTACCTGCGCCGCTGCGTCCGCCTGACCGACGAAGGCCTGCGCTACCTGGTGATCTACTGCGCCTCCATCAAGGAGCTGAGCGTCAGCGACTGCCGCTTCGTCAGCGACTTCGGCCTGCGGGAGATCGCCAAGCTGGAGTCCCGCCTGCGGTACCTGAGCATCGCGCACTGCGGCCGGGTCACCGACGTGGGCATCCGCTACGTGGCCAAGTACTGCAGCAAGCTGCGCTACCTCAACGCGAGGGGCTGCGAGGGCATCACGGACCACGGTGTGGAGTACCT

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hui-Wen Chiu et al.
Journal of clinical medicine, 7(10) (2018-10-12)
Paclitaxel (PTX) is a common regimen used to treat patients with ovarian cancer. Although approximately 60% of ovarian cancer patients exhibit a pathologic complete response (pCR), approximately 40% of patients appear to be insensitive to PTX adjuvant therapy. Thus, identifying
Loredana Moro et al.
Nature cell biology, 22(9), 1130-1142 (2020-08-26)
Epigenetic plasticity is a pivotal factor that drives metastasis. Here, we show that the promoter of the gene that encodes the ubiquitin ligase subunit FBXL7 is hypermethylated in advanced prostate and pancreatic cancers, correlating with decreased FBXL7 mRNA and protein

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico