Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU037901

Sigma-Aldrich

MISSION® esiRNA

targeting human USP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGACCCTGAGATGGGCAATTTCACAATTTGCTTCAGTAGAAAGGATTGTAGGAGAAGATAAATATTTCTGTGAAAACTGCCATCATTATACTGAAGCTGAACGAAGTCTTTTGTTTGACAAAATGCCTGAAGTTATAACTATTCATTTGAAGTGCTTTGCTGCTAGTGGTTTGGAGTTTGATTGTTATGGTGGTGGACTTTCCAAGATCAACACTCCTTTATTGACACCTCTTAAATTGTCACTAGAAGAATGGAGCACAAAGCCAACTAACGACAGCTATGGATTATTTGCGGTTGTGATGCATAGTGGCATTACAATTAGTAGTGGGCATTACACTGCTTCTGTTAAAGTCACTGACCTTAACAGTTTAGAACTAGATAAAGGAAATTTTGTGGTTGACCAAATGTGTGAAATAGGTAAGCCAGAACCATTGAATGAGGAGGAAGCAAGGGGTGTGGTTGAGAAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

M Raimondi et al.
Cell cycle (Georgetown, Tex.), 15(1), 106-116 (2016-01-16)
CAPNS1 is essential for the stability and function of ubiquitous CAPN1 and CAPN2. Calpain modulates by proteolytic cleavage many cellular substrates and its activity is often deregulated in cancer cells, therefore calpain inhibition has been proposed as a therapeutical strategy
Maura Sonego et al.
Science advances, 5(5), eaav3235-eaav3235 (2019-05-16)
Resistance to platinum-based chemotherapy is a common event in patients with cancer, generally associated with tumor dissemination and metastasis. Whether platinum treatment per se activates molecular pathways linked to tumor spreading is not known. Here, we report that the ubiquitin-specific
Dana Goldbraikh et al.
EMBO reports, 21(4), e48791-e48791 (2020-03-07)
PI3K-Akt-FoxO-mTOR signaling is the central pathway controlling growth and metabolism in all cells. Ubiquitination of the protein kinase Akt prior to its phosphorylation is required for PI3K-Akt activity. Here, we found that the deubiquitinating (DUB) enzyme USP1 removes K63-linked polyubiquitin

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico