Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU035971

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCKS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGAACTACACTTGGGCTCCTTTTTTTGTGCTCGACTTTTCCACCCTTTTTCCCTCCCTCCTGTGCTGCTGCTTTTTGATCTCTTCGACTAAAATTTTTTTATCCGGAGTGTATTTAATCGGTTCTGTTCTGTCCTCTCCACCACCCCCACCCCCCTCCCTCCGGTGTGTGTGCCGCTGCCGCTGTTGCCGCCGCCGCTGCTGCTGCTCGCCCCGTCGTTACACCAACCCGAGGCTCTTTGTTTCCCCTCTTGGATCTGTTGAGTTTCTTTGTTGAAGAAGCCAGCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGGAGAAGCCGCCGCGGAGAGGCCTGGGGAGGCGGCTGTGGCCTCGTCGCCTTCCAAAGCGAACGGACAGGAGAATGGCCACGTGAAGGTAAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cuong Van Dao et al.
The Journal of veterinary medical science, 79(12), 1931-1938 (2017-10-20)
Methylmercury (MeHg) is an environmental pollutant that shows severe toxicity to humans and animals. However, the molecular mechanisms mediating MeHg toxicity are not completely understood. We have previously reported that the MARCKS protein is involved in the MeHg toxicity to
Jun Li et al.
Journal of Cancer, 10(11), 2480-2487 (2019-07-02)
Objective: Recently, accumulating evidence has indicated that the 3' untranslated regions (3'UTRs) of protein coding genes play critical roles in the progression of various cancers, including ovarian cancer. This study is aimed to identify the potential role of SNAI2-3'UTR in
Ching-Hsien Chen et al.
Oncotarget, 6(17), 15194-15208 (2015-05-28)
Accumulating evidence has suggested that myristoylated alanine-rich C-kinase substrate (MARCKS) is critical for regulating multiple pathophysiological processes. However, the molecular mechanism underlying increased phosphorylation of MARCKS at Ser159/163 (phospho-MARCKS) and its functional consequence in neoplastic disease remain to be established.
C-H Chen et al.
Oncogene, 33(28), 3696-3706 (2013-08-21)
Myristoylated Alanine-Rich C Kinase Substrate (MARCKS), a substrate of protein kinase C, is a key regulatory molecule controlling mucus granule secretion by airway epithelial cells as well as directed migration of leukocytes, stem cells and fibroblasts. Phosphorylation of MARKCS may
Dan Yu et al.
Journal of the American Heart Association, 4(10), e002255-e002255 (2015-10-10)
Transcription of the myristoylated alanine-rich C kinase substrate (MARCKS) is upregulated in animal models of intimal hyperplasia. MARCKS knockdown inhibits vascular smooth muscle cell (VSMC) migration in vitro; however, the mechanism is as yet unknown. We sought to elucidate the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico