Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU035251

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Dong Fei et al.
Theranostics, 9(22), 6396-6411 (2019-10-08)
Effective therapeutic targets against post-myocardial infarction (MI) arrhythmias remain to be discovered. We aimed to investigate the role of macrophages in post-MI arrhythmias. Methods: Mononuclear cell accumulation, macrophage polarization from M0 to M1 subset, and gap junction formation were analyzed
Alban Girault et al.
Respiratory research, 16, 100-100 (2015-09-04)
Extensive alveolar epithelial injury and remodelling is a common feature of acute lung injury and acute respiratory distress syndrome (ARDS) and it has been established that epithelial regeneration, and secondary lung oedema resorption, is crucial for ARDS resolution. Much evidence
Chunling Huang et al.
Scientific reports, 6, 23884-23884 (2016-04-01)
Autophagy is emerging as an important pathway in many diseases including diabetic nephropathy. It is acknowledged that oxidative stress plays a critical role in autophagy dysfunction and diabetic nephropathy, and KCa3.1 blockade ameliorates diabetic renal fibrosis through inhibiting TGF-β1 signaling
Yu Liu et al.
Journal of Cancer, 6(7), 643-651 (2015-06-17)
The intermediate conductance calcium-activated potassium channel KCa3.1 plays an important role in regulating cell proliferation and migration. However, the role of KCa3.1 channel in human hepatocellular carcinoma remained unknown. This study was therefore performed to investigate the effects of KCa3.1
Etmar Bulk et al.
Oncotarget, 8(68), 112268-112282 (2018-01-20)
Early metastasis leads to poor prognosis of lung cancer patients, whose 5-year survival rate is only 15%. We could recently show that the Ca2+ sensitive K+ channel KCa3.1 promotes aggressive behavior of non-small cell lung cancer (NSCLC) cells and that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico