Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU035241

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNJ11

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCCTCATCTTCAGCAAGCATGCGGTGATCGCCCTGCGCCACGGCCGCCTCTGCTTCATGCTACGTGTGGGTGACCTCCGCAAGAGCATGATCATCAGCGCCACCATCCACATGCAGGTGGTACGCAAGACCACCAGCCCCGAGGGCGAGGTGGTGCCCCTCCACCAGGTGGACATCCCCATGGAGAACGGCGTGGGTGGCAACAGCATCTTCCTGGTGGCCCCGCTGATCATCTACCATGTCATTGATGCCAACAGCCCACTCTACGACCTGGCACCCAGCGACCTGCACCACCACCAGGACCTCGAGATCATCGTCATCCTGGAAGGCGTGGTGGAAACCACGGGCATCACCACCCAGGCCCGCACCTCCTACCTGGCCGATGAGATCCTGTGGGGCCAGCGCTTTGTGCCCATTGTAGCTGAGGAGGACGGACGTTACTCTGTGGACTACTCCAAGTTTGGCAACACC

Ensembl | nº de acceso humano

ENSG00000187486

Nº de acceso NCBI

NM_000525

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KCNJ11(3767) , KCNJ11(3767)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jie Qu et al.
Journal of neuroinflammation, 14(1), 228-228 (2017-11-28)
Long-term use of morphine induces analgesic tolerance, which limits its clinical efficacy. Evidence indicated morphine-evoked neuroinflammation mediated by toll-like receptor 4 (TLR4) - NOD-like receptor protein 3 (NLRP3) inflammasome was important for morphine tolerance. In our study, we investigated whether
Gintautas Grabauskas et al.
The Journal of physiology, 593(17), 3973-3989 (2015-07-16)
Ghrelin, a hunger signalling peptide derived from the peripheral tissues, overcomes the satiety signals evoked by anorexigenic molecules, such as cholecystokinin (CCK) and leptin, to stimulate feeding. Using in vivo and in vitro electrophysiological techniques, we show that ghrelin hyperpolarizes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico