Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU034291

Sigma-Aldrich

MISSION® esiRNA

targeting human FOS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | nº de acceso humano

ENSG00000170345

Nº de acceso NCBI

NM_005252

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FOS(2353) , FOS(2353)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
MSS
DIS
ZOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Peipei Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1212-1219 (2016-10-25)
Interleukin-1 receptor-associated kinase M (IRAK-M) is a well-known negative regulator for Toll-like receptor signaling, which can regulate immune homeostasis and tolerance in a number of pathological settings. However, the mechanism for IRAK-M regulation at transcriptional level remains largely unknown. In
Yahui Zhao et al.
The Journal of biological chemistry, 291(13), 6831-6842 (2016-02-10)
ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers.
Lianjie Hou et al.
Cells, 8(6) (2019-06-20)
Skeletal muscle plays an essential role in maintaining body energy homeostasis and body flexibility. Loss of muscle mass leads to slower wound healing and recovery from illness, physical disability, poor quality of life, and higher health care costs. So, it
Rui Bao et al.
American journal of translational research, 8(5), 2284-2292 (2016-06-28)
Forkhead/winged helix transcription factor p3 (Foxp3) increases in CD4(+)CD25(+)Treg cells during sepsis; however, related mechanisms are unclear. Our study aimed to explore the possible molecular mechanisms of high expression of Foxp3 in Treg cells during sepsis. Sepsis was induced by
Li Lin et al.
Journal of cellular physiology, 234(10), 18928-18941 (2019-04-21)
Pre-eclampsia (PE) is a serious hypertensive disorder of pregnancy that remains a leading cause of perinatal and maternal morbidity and mortality worldwide. Placental ischemia/hypoxia and the secretion of soluble fms-like tyrosine kinase 1 (sFlt1) into maternal circulation are involved in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico