Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU033871

Sigma-Aldrich

MISSION® esiRNA

targeting human EEF2K

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCAAACTCCTTCCACTTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCTGAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTCACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGAGGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAGTGGAAGGGCGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTGTACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGGCACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGACCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGA

Ensembl | nº de acceso humano

ENSG00000103319

Nº de acceso NCBI

NM_013302

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EEF2K(29904) , EEF2K(29904)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Y Cheng et al.
Oncogene, 35(49), 6293-6308 (2016-05-18)
Cancer cells predominantly metabolize glucose by glycolysis to produce energy in order to meet their metabolic requirement, a phenomenon known as Warburg effect. Although Warburg effect is considered a peculiarity critical for survival and proliferation of cancer cells, the regulatory
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico