Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU030131

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAG

Ensembl | nº de acceso humano

ENSG00000134318

Nº de acceso NCBI

NM_004850

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ROCK2(9475) , ROCK2(9475)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sarah Theresa Boyle et al.
Nature cell biology, 22(7), 882-895 (2020-05-27)
It is well accepted that cancers co-opt the microenvironment for their growth. However, the molecular mechanisms that underlie cancer-microenvironment interactions are still poorly defined. Here, we show that Rho-associated kinase (ROCK) in the mammary tumour epithelium selectively actuates protein-kinase-R-like endoplasmic
Ying-Ting Zhu et al.
The Journal of cell biology, 206(6), 799-811 (2014-09-10)
Currently there are limited treatment options for corneal blindness caused by dysfunctional corneal endothelial cells. The primary treatment involves transplantation of healthy donor human corneal endothelial cells, but a global shortage of donor corneas necessitates other options. Conventional tissue approaches
Ming-Ming Ma et al.
British journal of pharmacology, 173(3), 529-544 (2015-11-13)
Angiotensin II (AngII) induces migration and growth of vascular smooth muscle cell (VSMC), which is responsible for vascular remodelling in some cardiovascular diseases. Ang II also activates a Cl(-) current, but the underlying mechanism is not clear. The A10 cell
Ye Wang et al.
PloS one, 11(1), e0146646-e0146646 (2016-01-09)
Some recent studies suggest that multiple miRNAs might regulate neurogenic transdifferentiation of mesenchymal stromal cells (MSCs). In the present study, we hypothesized that the miR-124 can repress the expression of RhoA upon the neurogenesis of adipose derived MSCs (ADMSCs). MiRNA
Clarissa N Amaya et al.
BMC cancer, 17(1), 485-485 (2017-07-16)
The serine/threonine protein kinases ROCK1 and 2 are key RhoA-mediated regulators of cell shape and cytoskeletal dynamics. These proteins perform multiple functions in vascular endothelial cell physiology and are attractive targets for cancer therapy based on their roles as oncogenes
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico