Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU029771

Sigma-Aldrich

MISSION® esiRNA

targeting human MYD88

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTGTGTGTGTATCTGTCTGCCTGTCCATGTACTTCTGCCCTGCCTCCTCCTTTCGTTGTAGGAGGAATCTGTGCTCTACTTACCTCTCAATTCCTGGAGATGCCAACTTCACAGACACGTCTGCAGCAGCTGGACATCACATTTCATGTCCTGCATGGAACCAGTGGCTGTGAGTGGCATGTCCACTTGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGACCAGCAGAGCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Michele Cea et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(24), 6099-6109 (2016-06-12)
Nicotinamide phosphoribosyltransferase (Nampt) regulates intracellular NAD We investigated Nampt role in MW cells using both mRNA and protein expression analyses. We have also used loss-of-function approaches to investigate the growth and survival effects of Nampt on MW cells and further
Lingyu Zhang et al.
Gene, 700, 85-95 (2019-03-18)
MiR-155-3p, which is derived from the same pre-miRNA as miR-155-5p, the latter has been reported to be dysregulated in multiple tumor tissues and associated with clinicopathologic markers, tumor subtypes, and poor survival rates. However, the biological effects of miR-155-3p are
Xin Wen et al.
Journal of cellular physiology, 233(9), 7022-7034 (2018-01-31)
Epilepsy is a group of neurological disorders characterized by epileptic seizures. In this study, we aim to explore the role of microRNA-421 (miR-421) in hippocampal neurons of epilepsy mice via the TLR/MYD88 pathway. Forty mice were randomly served as the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico