Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU028581

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF2R

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTTATTCATCGCACTGGTGGTTATGAGGCTTATGATGAGAGTGAGGATGATGCCTCCGATACCAACCCTGATTTCTACATCAATATTTGTCAGCCACTAAATCCCATGCACGGAGTGCCCTGTCCTGCCGGAGCCGCTGTGTGCAAAGTTCCTATTGATGGTCCCCCCATAGATATCGGCCGGGTAGCAGGACCACCAATACTCAATCCAATAGCAAATGAGATTTACTTGAATTTTGAAAGCAGTACTCCTTGCTTAGCGGACAAGCATTTCAACTACACCTCGCTCATCGCGTTTCACTGTAAGAGAGGTGTGAGCATGGGAACGCCTAAGCTGTTAAGGACCAGCGAGTGCGACTTTGTGTTCGAATGGGAGACTCCTGTCGTCTGTCCTGATGAAGTGAGGATGGATGGC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5
Gui Yang et al.
The Journal of allergy and clinical immunology, 133(6), 1702-1708 (2014-04-05)
The functions of regulatory T (Treg) cells are important in immunity, and the regulatory mechanisms of Treg cell activities are not fully understood yet. We sought to investigate the role of insulin-like growth factor (IGF) 2 in the upregulation of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico