Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU028441

Sigma-Aldrich

MISSION® esiRNA

targeting human STIM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCCCTGCATGTCACTGAGTCCACCATGCTTTACAGAAGAAGACAGATTTAGTCTGGAAGCTCTTCAAACAATACATAAACAAATGGATGATGACAAAGATGGTGGAATTGAAGTAGAGGAAAGTGATGAATTCATCAGAGAAGATATGAAATATAAAGATGCTACTAATAAACACAGCCATCTGCACAGAGAAGATAAACATATAACGATTGAGGATTTATGGAAACGATGGAAAACATCAGAAGTTCATAATTGGACCCTTGAAGACACTCTTCAGTGGTTGATAGAGTTTGTTGAACTACCCCAATATGAGAAGAATTTTAGAGACAACAATGTCAAAGGAACGACACTTCCCAGGATAGCAGTGCACGAACCTTCATTTATGATCTCCCAGTTGAAAATCAGTGACCGGAGTCACAGACAAAAACTTCAGCTCAAGGCATTGGATGTGGTTTTGTTTGGACCTCTAACACGCCCACCTCAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiwang Chen et al.
Circulation, 135(16), 1532-1546 (2017-02-17)
Pulmonary arterial hypertension is a severe and progressive disease, a hallmark of which is pulmonary vascular remodeling. Nicotinamide phosphoribosyltransferase (NAMPT) is a cytozyme that regulates intracellular nicotinamide adenine dinucleotide levels and cellular redox state, regulates histone deacetylases, promotes cell proliferation
Vladimir A Vigont et al.
Frontiers in cell and developmental biology, 9, 625231-625231 (2021-02-20)
Huntington's disease (HD) is a severe autosomal-dominant neurodegenerative disorder caused by a mutation within a gene, encoding huntingtin protein. Here we have used the induced pluripotent stem cell technology to produce patient-specific terminally differentiated GABA-ergic medium spiny neurons modeling a
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Ruby A Fernandez et al.
American journal of physiology. Cell physiology, 308(8), C581-C593 (2015-02-13)
Pulmonary arterial hypertension (PAH) is a progressive disease that, if left untreated, eventually leads to right heart failure and death. Elevated pulmonary arterial pressure (PAP) in patients with PAH is mainly caused by an increase in pulmonary vascular resistance (PVR).
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico