Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU028021

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAGAAACTTCAGGCAGAACATCCATTCATTCATTCATTGGATTGTATATCATTGTTGCACAATCAGAATTGATAAGCACTGTTCCTCCACTCCAT

Ensembl | nº de acceso humano

ENSG00000137673

Nº de acceso NCBI

NM_002423

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP7(4316) , MMP7(4316)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
FPU
XCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ahmad Ghasemi et al.
Journal of cellular biochemistry, 119(2), 2333-2344 (2017-09-09)
Leptin, an adipokine secreted by adipose tissue, induces cell invasion and metastasis. MMP7 is a member of the matrix metalloproteinase family that plays an important role in cell invasion. Here we evaluate the possible role and underlying mechanism of MMP7
Sojoong Choi et al.
Oncotarget, 6(6), 3874-3886 (2015-02-18)
Because earlier studies showed the cell surface heparan sulfate proteoglycan, syndecan-2, sheds from colon cancer cells in culture, the functional roles of shed syndecan-2 were assessed. A non-cleavable mutant of syndecan-2 in which the Asn148-Leu149 residues were replaced with Asn148-Ile149
Q Zhang et al.
Oncogene, 36(5), 687-699 (2016-07-05)
Chronic inflammation has been associated with a variety of human cancers including prostate cancer. Interleukin-17 (IL-17) is a critical pro-inflammatory cytokine, which has been demonstrated to promote development of prostate cancer, colon cancer, skin cancer, breast cancer, lung cancer and
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico