Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU027961

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTCAGATGAACTGGATTGTTATCCGACTGAAGAACCAGCACCACAG

Ensembl | nº de acceso humano

ENSG00000070018

Nº de acceso NCBI

NM_002336

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LRP6(4040) , LRP6(4040)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xu Luo et al.
Neuroscience bulletin, 36(10), 1171-1181 (2020-06-21)
Neuronal apoptosis is one of the essential mechanisms of early brain injury after subarachnoid hemorrhage (SAH). Recently, HLY78 has been shown to inhibit apoptosis in tumor cells and embryonic cells caused by carbon ion radiation through activation of the Wnt/β-catenin
Jiaqi Xu et al.
Oncology letters, 14(5), 5638-5642 (2017-11-04)
The third member of the Dickkopf family (DKK-3), also known as reduced expression in immortalized cells (REIC), is a tumor suppressor present in a variety of tumor cells. Regarding the regulation of the Wnt/β-catenin signaling pathway, exogenous DKK-1 and DKK-2
Han Zhou et al.
JCI insight, 5(3) (2020-02-14)
Vascular inflammation is present in many cardiovascular diseases, and exogenous glucocorticoids have traditionally been used as a therapy to suppress inflammation. However, recent data have shown that endogenous glucocorticoids, acting through the endothelial glucocorticoid receptor, act as negative regulators of
Lei Wang et al.
Bone research, 6, 22-22 (2018-07-25)
Low-density lipoprotein receptor-related protein 6 (LRP6) is a co-receptor for Wnt signaling and can be recruited by multiple growth factors/hormones to their receptors facilitating intracellular signaling activation. The ligands that bind directly to LRP6 have not been identified. Here, we
Toshiaki Teratani et al.
The Journal of clinical investigation, 128(4), 1581-1596 (2018-03-20)
Incidence of nonalcoholic steatohepatitis (NASH), which is considered a hepatic manifestation of metabolic syndrome, has been increasing worldwide with the rise in obesity; however, its pathological mechanism is poorly understood. Here, we demonstrate that the hepatic expression of aortic carboxypeptidase-like
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico