Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU025391

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTGTCAACTCCACCAAGTCATCGTTGCTCGGTTTGCAGATGACCAGCTCATCATCGATTTTGATAATTTTGTTCGGTGTTTGGTTCGGCTGGAAACGCTATTCAAGATATTTAAGCAGCTGGATCCCGAGAATACTGGAACAATAGAGCTCGACCTTATCTCTTGGCTCTGTTTCTCAGTACTTTGAAGTTATAACTAATCTGCCTGAAGACTTCTCATGATGGAAAATCAGCCAAGGACTAAGCTTCCATAGAAATACACTTTGTATCTGGACCTCAAAATTATGGGAACATTTACTTAAACGGATGATCATAGCTGAAAATAATGATACTGTCAATTTGAGATAGCAGAAGTTTCACACATCAAAGTAAAAGATTTGCATATCATTATACTAAATGCAAATGAGTCGCTTAACCC

Ensembl | nº de acceso humano

ENSG00000162909

Nº de acceso NCBI

NM_001748

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CAPN2(824) , CAPN2(824)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this
Sheng Wang et al.
The Journal of biological chemistry, 292(20), 8291-8303 (2017-04-01)
Capsaicin is an ingredient in spicy peppers that produces burning pain by activating transient receptor potential vanilloid 1 (TRPV1), a Ca2+-permeable ion channel in nociceptors. Capsaicin has also been used as an analgesic, and its topical administration is approved for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico