Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU025001

Sigma-Aldrich

MISSION® esiRNA

targeting human CMKLR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACTTATCCCCCTTGGAAGCCAGGGTGACCAGGATCTTCCTGGTGGTGGTCTACAGCATCGTCTGCTTCCTCGGGATTCTGGGCAATGGTCTGGTGATCATCATTGCCACCTTCAAGATGAAGAAGACAGTGAACATGGTCTGGTTCCTCAACCTGGCAGTGGCAGATTTCCTGTTCAACGTCTTCCTCCCAATCCATATCACCTATGCCGCCATGGACTACCACTGGGTTTTCGGGACAGCCATGTGCAAGATCAGCAACTTCCTTCTCATCCACAACATGTTCACCAGCGTCTTCCTGCTGACCATCATCAGCTCTGACCGCTGCATCTCTGTGCTCCTCCCTGTCTGGTCCCAGAACCACCGCAGCGTTCGCCTGGCTTACATGGCCTGCATGGTCATCTGGGTCCTGGCTTTCTT

Ensembl | nº de acceso humano

ENSG00000174600

Nº de acceso NCBI

NM_004072

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CMKLR1(1240) , CMKLR1(1240)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan Wang et al.
Journal of cellular biochemistry, 120(4), 6459-6470 (2018-11-15)
Psoriasis is a chronic disease which carries the emotional and social burden, promotes joint disability and raises comorbidity possibility in patients. Obesity is closely correlated with the occurrence of psoriasis and adipokines produced by adipose tissues were found to be
Yixin Zhang et al.
Brain, behavior, and immunity, 70, 179-193 (2018-03-03)
Chemerin, an adipokine, has been reported to reduce the production of pro-inflammatory cytokines and neutrophil infiltration. This study investigated the role of Chemerin and its natural receptor, ChemR23, as well as its downstream mediator calmodulin-dependent protein kinase kinase 2 (CAMKK2)/adenosine
Yixin Zhang et al.
Cell death & disease, 10(2), 97-97 (2019-02-06)
Hypoxic-ischemic encephalopathy (HIE) is a devastating neurological event that contributes to the prolonged neurodevelopmental consequences in infants. Therapeutic strategies focused on attenuating neuronal apoptosis in the penumbra appears to be promising. Given the increasingly recognized neuroprotective roles of adipokines in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico