Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU024131

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCAGCATCTCCTCCTGGATCATCGCAGCCTGGACCGTGCGCGTCTGCGAGAGGTACCACGACAAGCAGGAAGTGACCAGCAACTTCCTGGGGGCCATGTGGCTGATTTCCATCACCTTCCTCTCCATTGGCTACGGCGACATGGTGCCCCACACCTACTGCGGGAAGGGTGTGTGCCTGCTCACTGGCATCATGGGAGCTGGCTGTACCGCGCTCGTGGTGGCTGTGGTGGCTCGGAAGCTGGAGCTCACCAAGGCTGAGAAGCACGTGCACAACTTCATGATGGACACTCAGCTCACCAAGCGGGTAAAAAACGCCGCTGCTAACGTTCTCAGGGAGACGTGGCTCATCTACAAACATACCAGGCTGGTGAAGAAGCCAGACCAAGCCCGGGTTCGGAAACACCAGCGTAAGTTCCTCCAAGCCATCCATCATGGCAGGATGCTCCGGAGTGTGAAGATCGAGCAAGGGAAGCTGAACGACCAGGCTAA

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Young-Jin Seo et al.
PloS one, 8(8), e75005-e75005 (2013-10-19)
Influenza continues to pose a threat to humans by causing significant morbidity and mortality. Thus, it is imperative to investigate mechanisms by which influenza virus manipulates the function of host factors and cellular signal pathways. In this study, we demonstrate
Heba Alshaker et al.
Frontiers in pharmacology, 10, 303-303 (2019-04-12)
Sphingosine kinases 1 and 2 (SK1 and SK2) are proto-oncogenic isozymes expressed in many human tumors and associated with chemoresistance and poor prognosis. They are well-recognized therapy targets and their inhibition was shown to induce tumor volume reduction and chemosensitization
Ilari Pulli et al.
Biochimica et biophysica acta, 1853(9), 2173-2182 (2015-04-22)
Caveolae are plasma membrane invaginations enriched in sterols and sphingolipids. Sphingosine kinase 1 (SK1) is an oncogenic protein that converts sphingosine to sphingosine 1-phosphate (S1P), which is a messenger molecule involved in calcium signaling. Caveolae contain calcium responsive proteins, but

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico