Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU024031

Sigma-Aldrich

MISSION® esiRNA

targeting human SP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTTCCTGGTCAAACCCAAGTAGTTGCTAATGTGCCTCTTGGTCTGCCAGGAAATATTACGTTTGTACCAATCAATAGTGTCGATCTAGATTCTTTGGGACTCTCGGGCAGTTCTCAGACAATGACTGCAGGCATTAATGCCGACGGACATTTGATAAACACAGGACAAGCTATGGATAGTTCAGACAATTCAGAAAGGACTGGTGAGCGGGTTTCTCCTGATATTAATGAAACTAATACTGATACAGATTTATTTGTGCCAACATCCTCTTCATCACAGTTGCCTGTTACGATAGATAGTACAGGTATATTACAACAAAACACAAATAGCTTGACTACATCTAGTGGGCAGGTTCATTCTTCAGATCTTCAGGGAAATTATATCCAGTCGCCTGTTTCTGAAGAGACACAGGCACAGAATATTCAGGTTTCTACAGCACAGCCTGTTGTACAGCATCTACAACTTCAAGAGTCTCAGCAGCCAACCAGT

Ensembl | nº de acceso humano

ENSG00000172845

Nº de acceso NCBI

NM_003111

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SP3(6670) , SP3(6670)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan-Yan Xu et al.
Scientific reports, 7(1), 2090-2090 (2017-05-20)
Stimulator of Interferon Gene (STING) is a key mediator of innate immune signaling. STING plays a pivotal role in the pathogenesis of many diseases including infectious diseases, auto-immune diseases and cancer. Many studies have been carried out recently in the
Yinxian Wen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12834-12846 (2020-08-09)
Maternal dexamethasone decreases the body length of the newborn. However, whether dexamethasone inhibits the development of the growth plate of the fetal long bone is still unknown. Here, we found that lengths of fetal femur and growth plate were both
Shawn T Beug et al.
Science signaling, 12(566) (2019-01-31)
The controlled production and downstream signaling of the inflammatory cytokine tumor necrosis factor-α (TNF-α) are important for immunity and its anticancer effects. Although chronic stimulation with TNF-α is detrimental to the health of the host in several autoimmune and inflammatory
Michael A Peplowski et al.
Journal of molecular medicine (Berlin, Germany), 96(10), 1081-1093 (2018-08-10)
Aquaporin (AQP) 3 expression is altered in inflammatory bowel diseases, although the exact mechanisms regulating AQP abundance are unclear. Although interferon gamma (IFNγ) is centrally involved in intestinal inflammation, the effect of this cytokine on AQP3 expression remains unknown. HT-29

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico