Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU023641

Sigma-Aldrich

MISSION® esiRNA

targeting human NR2F2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAACTGCCACTCGTACCTGTCCGGATATATTTCCCTGCTGTTGCGCGCGGAGCCCTATCCCACGTCGCGCTTCGGCAGCCAATGCATGCAGCCCAACAACATCATGGGTATCGAGAACATTTGCGAACTGGCCGCGAGGATGCTCTTCAGCGCCGTCGAGTGGGCCCGGAACATCCCCTTCTTCCCCGACCTGCAGATCACGGACCAGGTGGCCCTGCTTCGCCTCACCTGGAGCGAGCTGTTTGTGTTGAATGCGGCGCAGTGCTCCATGCCCCTCCACGTCGCCCCGCTCCTGGCCGCCGCCGGCCTGCATGCTTCGCCCATGTCCGCCGACCGGGTGGTCGCCTTTATGGACCACATACGGATCTTCCAAGAGCAAGTGGAGAAGCTCAAGGCGCTGCACGTTGACTCAGCCGAGTACAGCTGCCTCAAGGCCATAGTCCTGTTCACCTCAGATGCCTGTGGTCTCTCTGATGTAGCCCATGTGGAAAGC

Ensembl | nº de acceso humano

ENSG00000185551

Nº de acceso NCBI

NM_021005

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NR2F2(7026) , NR2F2(7026)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SPR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Baoguo Zhou et al.
Molecular carcinogenesis, 55(12), 2260-2267 (2016-01-23)
Colorectal cancer (CRC) is one of the leading causes of cancer death worldwide. MiR-382 has been found to have a decreased expression and the ability to suppress tumorigenesis in certain cancers. However, the role of miR-382 in CRC has not
Shigeaki Kanatani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(36), E4985-E4994 (2015-08-26)
The preoptic area (POa) of the rostral diencephalon supplies the neocortex and the amygdala with GABAergic neurons in the developing mouse brain. However, the molecular mechanisms that determine the pathway and destinations of POa-derived neurons have not yet been identified.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico