Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU021911

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGTGGCACAATCGGACTTATTCACGCAGTGGCCAATAATCAAGACAAACTGGGATTTGAGGATGGATCAGTTCTGAAACAGTTTCTTTCTGAAACAGAGAAAATGTCCCCTGAAGACAGAGCAAAATGCTTTGAAAAGAATGAGGCCATACAGGCAGCCCATGATGCCGTGGCACAGGAAGGCCAATGTCGGGTAGATGACAAGGTGAATTTCCATTTTATTCTGTTTAACAACGTGGATGGCCACCTCTATGAACTTGATGGACGAATGCCTTTTCCGGTGAACCATGGCGCCAGTTCAGAGGACACCCTGCTGAAGGACGCTGCCAAGGTCTGCAGAGAATTCACCGAGCGTGAGCAAGGAGAAGTCCGCTTCTCTGCCGTGGCTCTCTGCAAGGCAGCCTAATGCTCTGTGGGAGGGAC

Ensembl | nº de acceso humano

ENSG00000154277

Nº de acceso NCBI

NM_004181

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... UCHL1(7345) , UCHL1(7345)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuyin Xu et al.
Experimental cell research, 382(2), 111463-111463 (2019-06-28)
Diabetic nephrology (DN) is attributed largely to the depletion of podocytes, which is closely associated to apoptosis. However, the complex mechanism of podocyte loss in DN pathogenesis remains unclear. Recently, necroptosis has emerged as an important cell death model in
Yanhong Luo et al.
Journal of cellular biochemistry, 119(1), 691-700 (2017-06-22)
As a de-ubiquitin enzyme, ubiquitin C-terminal hydrolase (UCH)-L1 has been shown to be overexpressed in several human cancers. However, the function of UCH-L1 in invasion of breast cancers is still unclear. Here we report that the expression of UCH-L1 is
Wenjuan Wang et al.
Molecular carcinogenesis, 55(9), 1329-1342 (2015-08-22)
Multidrug resistant (MDR) cancer cells overexpressing P-glycoprotein (P-gp) exhibit enhanced invasive/metastatic ability as compared with the sensitive cells. We aimed to clarify the mechanism underlying this observation and found that during the development of drug resistance to adriamycin in MCF7
Eun Young Seo et al.
The Journal of investigative dermatology, 137(8), 1757-1765 (2017-04-11)
Ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is involved in many signaling pathways via the ubiquitin-proteasome system. UCHL1 is expressed in the human skin and serves as a neuronal marker; however, its functions in melanogenesis remain unknown. Here, we investigated the role
Hongbo Gao et al.
Biochemical and biophysical research communications, 492(1), 96-102 (2017-08-15)
Skeletal muscles are dynamic tissues that possess regenerative abilities, which require multiple processes and regulatory factors. Ubiquitin C-Terminal Hydrolase L1 (UCHL1), which is primarily expressed in neuronal tissues, was upregulated in skeletal muscles in disease conditions but its functional role
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico