Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU020491

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CFTR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGG

Ensembl | nº de acceso humano

ENSG00000001626

Nº de acceso NCBI

NM_000492

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CFTR(1080) , CFTR(1080)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descripción general

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dexamethasone regulates CFTR expression in Calu-3 cells with the involvement of chaperones HSP70 and HSP90.

Luiz Felipe M Prota et al.

PloS one, 7(12), e47405-e47405 (2012-12-29)

Dexamethasone is widely used for pulmonary exacerbation in patients with cystic fibrosis, however, not much is known about the effects of glucocorticoids on the wild-type cystic fibrosis channel transmembrane regulator (CFTR). Our aim was to determine the effects of dexamethasone

Na+/H+ exchanger regulatory factor 1 overexpression-dependent increase of cytoskeleton organization is fundamental in the rescue of F508del cystic fibrosis transmembrane conductance regulator in human airway CFBE41o- cells.

Maria Favia et al.

Molecular biology of the cell, 21(1), 73-86 (2009-11-06)

We have demonstrated that Na(+)/H(+) exchanger regulatory factor 1 (NHERF1) overexpression in CFBE41o- cells induces a significant redistribution of F508del cystic fibrosis transmembrane conductance regulator (CFTR) from the cytoplasm to the apical membrane and rescues CFTR-dependent chloride secretion. Here, we

Cystic fibrosis transmembrane conductance regulator protein (CFTR) expression in the developing human brain: comparative immunohistochemical study between patients with normal and mutated CFTR.

Pascale Marcorelles et al.

The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society, 62(11), 791-801 (2014-07-27)

Cystic Fibrosis Transmembrane conductance Regulator (CFTR) protein has recently been shown to be expressed in the human adult central nervous system (CNS). As CFTR expression has also been documented during embryonic development in several organs, such as the respiratory tract

A non-viral nano-delivery system targeting epigenetic methyltransferase EZH2 for precise acute myeloid leukemia therapy.

Babita Kaundal et al.

Journal of materials chemistry. B, 8(37), 8658-8670 (2020-08-28)

Acute myeloid leukemia (AML), which is common in the elderly population, accounts for poor long-term survival with a high possibility of relapse. The associated lack of currently developed therapeutics is directing the search for new therapeutic targets relating to AML.

Roscovitine is a proteostasis regulator that corrects the trafficking defect of F508del-CFTR by a CDK-independent mechanism.

C Norez et al.

British journal of pharmacology, 171(21), 4831-4849 (2014-07-30)

The most common mutation in cystic fibrosis (CF), F508del, causes defects in trafficking, channel gating and endocytosis of the CF transmembrane conductance regulator (CFTR) protein. Because CF is an orphan disease, therapeutic strategies aimed at improving mutant CFTR functions are

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico