Saltar al contenido
Merck

EHU020381

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGATAACGGCACCTACACTTGCGAGGCGTCCAATAAGCACGGCCATGCGAGGGCGCTCTACGTACTTGTGGTCTACGACCCTGGTGCGGTGGTAGAGGCTCAGACGTCGGTTCCCTATGCCATTGTGGGCGGCATCCTGGCGCTGCTGGTGTTTCTGATCATATGTGTGCTAGTGGGCATGGTCTGGTGCTCGGTACGGCAGAAGGGTTCCTATCTGACCCACGAAGCCAGTGGCTTGGATGAACAGGGAGAAGCAAGAGAAGCCTTCCTCAATGGCAGCGACGGACACAAGAGGAAAGAGGAATTCTTCATCTGACCCTATCCCCACCCCAGGCCTAGGCCTGGGCCTGGGCTGGGGTCCCCCCCACTGCCAGCTGCAAGGAACCAGCAAAGACATTTACCAGAGTCTGGGATGGTGGGCTTCTCCCCCCACCACTAACACCTCAGACGCTTGGGCAGGGATGGGGGTGTTGGATGCCTGGATCTCTGTAAGGGCCAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fang Luo et al.
The international journal of biochemistry & cell biology, 123, 105750-105750 (2020-04-24)
Cell adhesion molecule 4 (CADM4) is downregulated in many human cancers. However, CADM4 expression levels in human non-small cell lung cancer (NSCLC) tissues and its roles in NSCLC progression remain unknown. Our study aims to address these issues. We examined
Shruthy Suresh et al.
PLoS genetics, 13(3), e1006650-e1006650 (2017-03-09)
Hepatocellular carcinoma (HCC) is the fifth most common solid tumor in the world and the third leading cause of cancer-associated deaths. A Sleeping Beauty-mediated transposon mutagenesis screen previously identified mutations that cooperate with MYC to accelerate liver tumorigenesis. This revealed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico