Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU020001

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTGACAGCCTTCTACCG

Ensembl | nº de acceso humano

ENSG00000126456

Nº de acceso NCBI

NM_001571

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IRF3(3661) , IRF3(3661)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiao-Hua Wang et al.
The international journal of biochemistry & cell biology, 87, 8-17 (2017-03-25)
Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis in infancy, which is a major risk factor for recurrent wheezing and asthma. Orosomucoid 1-like protein 3 (ORMDL3) has been reported to associate with virus-triggered recurrent wheezing and asthma in
Nanae Harashima et al.
Molecular cancer, 13, 217-217 (2014-09-18)
Synthetic double-stranded RNA poly(I:C) is a useful immune adjuvant and exhibits direct antitumor effects against several types of cancers. In this study, we elucidated the mechanisms underlying the effects induced in poly(I:C)-transfected human renal cell carcinoma (RCC) cells. In contrast
Danielle N Kroetz et al.
PLoS pathogens, 11(12), e1005338-e1005338 (2015-12-29)
Influenza A virus (IAV) is an airborne pathogen that causes significant morbidity and mortality each year. Macrophages (Mϕ) are the first immune population to encounter IAV virions in the lungs and are required to control infection. In the present study
Iris F Ueki et al.
The Journal of experimental medicine, 210(10), 1929-1936 (2013-09-04)
Viruses suppress host responses to increase infection, and understanding these mechanisms has provided insights into cellular signaling and led to novel therapies. Many viruses (e.g., Influenza virus, Rhinovirus [RV], Cytomegalovirus, Epstein-Barr virus, and Hepatitis C virus) activate epithelial epidermal growth
Koji Hirono et al.
Modern rheumatology, 30(6), 1074-1081 (2019-10-19)
Background: Endothelial expression of membrane-bound fractalkine/CX3CL1 (Fkn) reportedly acts as a strong mediator of inflammation. Toll-like receptor 3 (TLR3) axes are thought to play some roles in the development of chronic glomerulonephritis (CGN) including lupus nephritis (LN). However, detailed mechanism
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico