Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU019581

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2C

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCTCCTCAGCTCTACGTCTAAATACAAAGTGACAGTGGCTGAAGTACAGAGGCGACTGTCCCCACCTGAATGCTTAAATGCCTCGTTACTGGGAGGTGTTCTCAGAAGAGCCAAATCGAAAAATGGAGGCCGGTCCTTGCGGGAGAAGTTGGACAAGATTGGGTTGAATCTTCCGGCCGGGAGGCGGAAAGCCGCTCATGTGACTCTCCTGACATCCTTAGTAGAAGGTGAAGCTGTTCATTTGGCTAGGGACTTTGCCTATGTCTGTGAAGCCGAATTTCCTAGTAAACCAGTGGCAGAATATTTAACCAGACCTCATCTTGGAGGACGAAATGAGATGGCAGCTAGGAAGAACATGCTATTGGCGGCCCAGCAACTGTGTAAAGAATTCACAGAACTTCTCAGCCAAGACCGGACACCCCATGGGACCAGCAGGCTCGCCCCAGTCTTGGAGACGAACATACAGAACTGCTTGTCTCATTTCAGCCTGATTACCCACG

Ensembl | nº de acceso humano

ENSG00000087510

Nº de acceso NCBI

NM_003222

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TFAP2C(7022) , TFAP2C(7022)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J Kang et al.
Oncogene, 36(11), 1585-1596 (2016-09-07)
Non-small cell lung cancer (NSCLC) remains one of the leading causes of death worldwide, and thus new molecular targets need to be identified to improve treatment efficacy. Although epidermal growth factor receptor (EGFR)/KRAS mutation-driven lung tumorigenesis is well understood, the
Wanyeon Kim et al.
Experimental & molecular medicine, 48(11), e273-e273 (2016-11-26)
TFAP2C (transcription factor-activating enhancer-binding protein 2C) expression has been positively correlated with poor prognosis in patients with certain types of cancer, but the mechanisms underlying TFAP2C-mediated tumorigenesis in non-small-cell lung cancer (NSCLC) are still unknown. We previously performed a microarray
Lingjie Li et al.
Cell stem cell, 24(2), 271-284 (2019-01-29)
Tissue development results from lineage-specific transcription factors (TFs) programming a dynamic chromatin landscape through progressive cell fate transitions. Here, we define epigenomic landscape during epidermal differentiation of human pluripotent stem cells (PSCs) and create inference networks that integrate gene expression
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico