Saltar al contenido
Merck

EHU019271

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

D J Kim et al.
Journal of dental research, 98(13), 1511-1520 (2019-10-19)
A strong correlation between chronic periodontitis and systemic diseases (e.g., cardiovascular disease, metabolic disorders) has been suggested for several decades. However, the evidence supporting this correlation is restricted primarily to epidemiologic studies, with only a few experimental outcomes confirming such
Ying Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 272-279 (2016-12-05)
FABP4 is widely expressed in both normal and pathologic tissues. It promotes cell proliferation, survival and migration of endothelial cells, and therefore, angiogenesis. However, the role of FABP4 in hemangioma or hemangioma endothelial cells (HemECs) has not been explored. In
U Harjes et al.
Oncogene, 36(7), 912-921 (2016-08-30)
Fatty acid binding protein 4 (FABP4) is a fatty acid chaperone, which is induced during adipocyte differentiation. Previously we have shown that FABP4 in endothelial cells is induced by the NOTCH1 signalling pathway, the latter of which is involved in
Mingguo Huang et al.
Oncotarget, 8(67), 111780-111794 (2018-01-18)
Fatty acid binding protein 4 (FABP4) is an abundant protein in adipocytes, and its production is influenced by high-fat diet (HFD) or obesity. The prostate stromal microenvironment induces proinflammatory cytokine production, which is key for the development and progression of
Sanjay Basak et al.
Molecular and cellular biochemistry, 437(1-2), 55-64 (2017-06-18)
Adequate placental angiogenesis is critical for the establishment of the placental circulation and thus for normal feto-placental growth and development. Fatty acid-binding protein-4 (FABP4) plays a pro-angiogenic role in endothelial cells; however, very little information is available in placental first

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico