Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU018291

Sigma-Aldrich

MISSION® esiRNA

targeting human BCAP31

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGA

Ensembl | nº de acceso humano

ENSG00000185825

Nº de acceso NCBI

NM_005745

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BCAP31(10134) , BCAP31(10134)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuya Yang et al.
Frontiers in molecular biosciences, 7, 107-107 (2020-06-26)
Cervical cancer (CC) is the most common malignant tumor in gynecology, and metastasis is an important cause of patient death. MiRNAs (microRNAs) have been found to play key roles in cervical cancer metastasis, but the effect of miR-362-3p in CC
Shuya Yang et al.
Cancer medicine, 10(1), 305-316 (2020-11-20)
BAP31 (B-cell receptor-associated protein 31) is an important regulator of intracellular signal transduction and highly expressed in several cancer tissues or testicular tissues. Our previous study had revealed that elevated BAP31 plays a crucial role in the progress and metastasis
Kayo Machihara et al.
Cells, 8(11) (2019-11-02)
Cancer cells modulate their metabolism to proliferate and survive under the metabolic stress condition, which is known as endoplasmic reticulum (ER) stress. Therefore, cancer cells should suppress ER stress-mediated cell death and induce autophagy-which recycles metabolites to provide energy and
Takushi Namba
Science advances, 5(6), eaaw1386-eaaw1386 (2019-06-18)
The endoplasmic reticulum (ER) is composed of large membrane-bound compartments, and its membrane subdomain appears to be in close contact with mitochondria via ER-mitochondria contact sites. Here, I demonstrate that the ER membrane protein, BAP31, acts as a key factor
Won-Tae Kim et al.
Stem cells (Dayton, Ohio), 32(10), 2626-2641 (2014-06-06)
B-Cell receptor-associated protein 31 (BAP31) regulates the export of secreted membrane proteins from the endoplasmic reticulum (ER) to the downstream secretory pathway. Previously, we generated a monoclonal antibody 297-D4 against the surface molecule on undifferentiated human embryonic stem cells (hESCs).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico