Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU017231

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC22A5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCTGCCACTGTTTGCTTACTTCATCCGAGACTGGCGGATGCTGCTGGTGGCGCTGACGATGCCGGGGGTGCTATGCGTGGCACTCTGGTGGTTCATCCCTGAGTCCCCCCGATGGCTCATCTCTCAGGGACGATTTGAAGAGGCAGAGGTGATCATCCGCAAGGCTGCCAAAGCCAATGGGATTGTTGTGCCTTCCACTATCTTTGACCCGAGTGAGTTACAAGACCTAAGTTCCAAGAAGCAGCAGTCCCACAACATTCTGGATCTGCTTCGAACCTGGAATATCCGGATGGTCACCATCATGTCCATAATGCTGTGGATGACCATATCAGTGGGCTATTTTGGGCTTTCGCTTGATACTCCTAACTTGCATGGGGACATCTTTGTGAACTGCTTCCTTTCAGCGATGGTTGAAGTCCCAGCAT

Ensembl | nº de acceso humano

ENSG00000197375

Nº de acceso NCBI

NM_003060

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC22A5(6584) , SLC22A5(6584)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kei Higuchi et al.
Drug metabolism and pharmacokinetics, 30(2), 182-187 (2015-04-11)
Memantine is clinically used for the treatment of patients with Alzheimer's disease and is highly distributed to the brain. The aim of this study is to characterize memantine transport at the blood-brain barrier (BBB) using hCMEC/D3 cells, a human BBB
Mitsuko Akaihata et al.
Molecular and cellular biochemistry, 459(1-2), 49-59 (2019-05-18)
Glucocorticoid (GC) resistance is associated with poor response to the following chemotherapy in lymphoid malignancies, such as lymphoma and leukemia. However, it remains unclear whether GCs interfere with the cytotoxic effects of anti-cancer drugs on GC-resistant cells. In this study
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico