Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU016891

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINE1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGTTCTGCCCAAGTTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGACATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTCGCGCAGGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCATCCACAGCTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCCTTCCTCTTTGTGGTCCGGCACAACCCCACAGGAACAGTCCTTTTCATGGGCCAAGTGATGGAACCCTGACCCTGGGGAAAGACGCCTTCATCTGGGACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTTTAGTGTTAATGACTCTTTCTGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCAGATCTGTCTCCAAGACCTTGGCCTCTCCTTGGAGGACCTTT

Ensembl | nº de acceso humano

ENSG00000106366

Nº de acceso NCBI

NM_000602

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SERPINE1(5054) , SERPINE1(5054)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hyeon-Joon Kong et al.
International journal of oncology, 58(1), 111-121 (2020-12-29)
Serpin family E member 1 (SERPINE1), a serine proteinase inhibitor, serves as an important regulator of extracellular matrix remodeling. Emerging evidence suggests that SERPINE1 has diverse roles in cancer and is associated with poor prognosis. However, the mechanism via which SERPINE1 is induced
En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Mike R Wilson et al.
Cell reports, 33(6), 108366-108366 (2020-11-12)
Endometriosis affects 1 in 10 women and is characterized by the presence of abnormal endometrium at ectopic sites. ARID1A mutations are observed in deeply invasive forms of the disease, often correlating with malignancy. To identify epigenetic dependencies driving invasion, we
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico