Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU015821

Sigma-Aldrich

MISSION® esiRNA

targeting human CD2AP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGGCTGGAAGGAGAACTAAATGGGAGAAGAGGAATGTTCCCTGACAATTTCGTTAAGGAAATTAAAAGAGAGACGGAATTCAAGGATGACAGTTTGCCCATCAAACGGGAAAGGCATGGGAATGTAGCAAGTCTTGTACAACGAATAAGCACCTATGGACTTCCAGCTGGAGGAATTCAGCCACATCCACAAACCAAAAACATTAAGAAGAAGACCAAGAAGCGTCAGTGTAAAGTTCTTTTTGAGTACATTCCACAAAATGAGGATGAACTGGAGCTGAAAGTGGGAGATATTATTGATATTAATGAAGAGGTAGAAGAAGGCTGGTGGAGTGGAACCCTGAATAACAAGTTGGGACTGTTTCCCTCAAATTTTGTGAAAGAATTAGAGGTAACAGATGATGGTGAAACTCATGAAGCCCAGGA

Ensembl | nº de acceso humano

ENSG00000198087

Nº de acceso NCBI

NM_012120

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD2AP(23607) , CD2AP(23607)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hye-Young Park et al.
The international journal of biochemistry & cell biology, 79, 370-381 (2016-09-04)
Angiotensin II (Ang II) works as a paracrine or autocrine cytokine agent to regulate renal functions and promotes podocytes dysfunction directly or indirectly, causing proteinuria. The glomerular slit diaphragm (SD) serves as a size-selective barrier and is linked to the
Dao Wang et al.
OncoTargets and therapy, 13, 6681-6697 (2020-08-09)
Pediatric acute promyelocytic leukemia (APL) accounts for 10% of pediatric acute myelogenous leukemia (AML) case and is accompanied by a tendency to hemorrhage. miR-188-5p plays an important role in adult AML. Therefore, the purpose of this study was to explore

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico