Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU015391

Sigma-Aldrich

MISSION® esiRNA

targeting human PARN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGTTTTCCCGAAACCCTTCAATAGATCCTCACCAGATGTCAAATTTGTTTGTCAGAGCTCCAGCATTGACTTTCTAGCAAGCCAGGGATTTGATTTTAATAAAGTTTTTCGAAATGGAATTCCATATTTAAATCAGGAAGAAGAAAGACAGTTAAGAGAGCAGTATGATGAAAAACGTTCACAGGCGAATGGTGCAGGAGCTCTGTCCTATGTATCTCCTAACACTTCAAAATGTCCTGTCACGATTCCTGAGGATCAAAAGAAGTTTATTGACCAAGTGGTAGAGAAAATAGAGGATTTATTACAAAGTGAAGAAAACAAGAACTTGGATTTAGAGCCATGTACCGGGTTCCAAAGAAAACTAATTTATCAGACTTTGAGCTGGAAGTATCCGAAAGGCATTCATGTTGAGACTTTAGAAACTGAAAAGAAGGAGCGATATATAGTTATCAGCAAAGTAGATGAAGAAGAACGCAAAAGAAGAGAGCAGCAGAAACATGCCAAAGA

Ensembl | nº de acceso humano

ENSG00000140694

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PARN(5073) , PARN(5073)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Blanca Nieto et al.
Nature communications, 11(1), 156-156 (2020-01-11)
Technical problems intrinsic to the purification of preribosome intermediates have limited our understanding of ribosome biosynthesis in humans. Addressing this issue is important given the implication of this biological process in human disease. Here we report a preribosome purification and
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico