Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU014951

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAATCAGAGAGATTCCAAGAAATATAGGAGAATTGAGAAATTTGGTTAGTTTACATGCATACAATAATCAAATAAGTTATCTTCCACCATCTTTGCTATCTTTAAATGATCTGCAGCAACTAAACCTGAGTGGAAATAATCTGACAGCTCTACCTAGTGCTATCTACAATATTTTTTCACTGAAGGAGATAAATTTTGATGACAACCCTTTGCTGAGACCTCCAGTGGAAATCTGTAAAGGAAAACAGTTGTATACTATTGCACGCTATCTACAGAGGGCAGATGAAAGAGATGAGAAAATTTTAGAGAAGATATTCAAGATAGTTGCCAACAACATCACTGAAACCAATTTTGAATTTTTATGTCAAAAACTAAACCTGGCAAACTCAGAAACTGATATGCCTACAAAGAGCACTGTTTCATTAAGTGAGAGAGCCCACCAAGCACTTGTTATATGGAAAACACAAAGTAACAAGTTATCACTAACTGCTGCTGCTTTAAGAGATCA

Ensembl | nº de acceso humano

ENSG00000188693

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... LRRD1(401387) , NR4A3(8013)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alexander J A Deutsch et al.
Cancer research, 77(9), 2375-2386 (2017-03-03)
Nuclear orphan receptor NR4A1 exerts an essential tumor suppressor function in aggressive lymphomas. In this study, we investigated the hypothesized contribution of the related NR4A family member NR4A3 to lymphomagenesis. In aggressive lymphoma patients, low expression of NR4A3 was associated
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into
Xiao-Jun Feng et al.
British journal of pharmacology, 172(11), 2852-2863 (2015-01-28)
The orphan nuclear receptor NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, and is involved in glucose and fat metabolism. However, its potential contribution to cardiovascular diseases remains to be assessed. Here, the roles of NOR1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico