Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU013251

Sigma-Aldrich

MISSION® esiRNA

targeting human SULT2A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGTTTGACCACATTCATGGCTGGATGCCCATGAGAGAGGAGAAAAACTTCCTGTTACTGAGTTATGAGGAGCTGAAACAGGACACAGGAAGAACCATAGAGAAGATCTGTCAATTCCTGGGAAAGACGTTAGAACCCGAAGAACTGAACTTAATTCTCAAGAACAGCTCCTTTCAGAGCATGAAAGAAAACAAGATGTCCAATTATTCCCTCCTGAGTGTTGATTATGTAGTGGACAAAGCACAACTTCTGAGAAAAGGTGTATCTGGGGACTGGAAAAATCACTTCACAGTGGCCCAAGCTGAAGACTTTGATAAATTGTTCCAAGAGAAGATGGCAGATCTTCCTCGAGAGCTGTTCCCATGGGAATAACGTCCAAAACACTCTGGATCTTATATGGAGAATGACATTGATTCTCCTGTCCTTGTACATGTACCTGACTGGGGTCATTGTGTAAGACTTATTATTTTATCCTGAAACCTTAAATATCAAACCTCTGCATCTCTGATCCCTTCC

Ensembl | nº de acceso humano

ENSG00000105398

Nº de acceso NCBI

NM_003167

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SULT2A1(6822) , SULT2A1(6822)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33
S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico