Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU012341

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGGAAATTTGTCTTGATCCAGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACGGTGGAAACAAGGAAAACTGATTAAGAGAAATGAGCACGCATGGAAAAGTTTCCCAGTCTTCAGCAGAGAAGTTTTCTGGAGGTCTCTGAACCCAGGGAAGACAAGAAGGAAAGATTTTGTTGTTGTTTGTTTATTTGTTTTTCCAGTAGTTAGCTTTCTTCCTGGATTCCTCACTTTGAAGAGTGTGAGGAAAACCTATGTTTGCCGCTTAAGCTTTCAGCTCAGCTAATGAAGTGTTTAGCATAGTACCTCTGCTATTTGCTGTTATTTTATCTGCTATGCTATTGAAGTTTTGGCAATTGACTATAGTGTGAGCCAGGAATCACTG

Ensembl | nº de acceso humano

ENSG00000163735

Nº de acceso NCBI

NM_002994

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CXCL5(6374) , CXCL5(6374)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhijie Dai et al.
Oncology reports, 36(6), 3303-3310 (2016-10-18)
CXCL5 and its receptor CXCR2 have been found to be involved in tumorigenesis and cancer progression. Recent studies have shown that CXCR2 is upregulated in glioma tissues, and associated with poor prognosis and recurrence. However, the role of CXCL5/CXCR2 signaling in
Hongsheng Dang et al.
Oncology research, 25(2), 177-186 (2017-03-10)
CXCL5, a CXC-type chemokine, is an important attractant for granulocytic immune cells by binding to its receptor CXCR2. Recently, CXCL5/CXCR2 has been found to play an oncogenic role in many human cancers. However, the exact role of CXCL5 in osteosarcoma
Toshiyuki Mitsuyama et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 15(3), 271-280 (2015-03-31)
Characteristics of type 2 autoimmune pancreatitis (AIP) is granulocyte epithelial lesions, called idiopathic duct-centric pancreatitis (IDCP). To clarify pathogenesis of IDCP, we investigated mechanism of neutrophil infiltration in type 1 AIP, called lymphoplasmacytic sclerosing pancreatitis (LPSP) and IDCP. This study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico