Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU010991

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC1A3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTCTCCTTTCCTGGGGAACTTCTGATGAGGATGTTACAGATGCTGGTCTTACCACTTATCATCTCCAGTCTTGTCACAGGAATGGCGGCGCTAGATAGTAAGGCATCAGGGAAGATGGGAATGCGAGCTGTAGTCTATTATATGACTACCACCATCATTGCTGTGGTGATTGGCATAATCATTGTCATCATCATCCATCCTGGGAAGGGCACAAAGGAAAACATGCACAGAGAAGGCAAAATTGTACGAGTGACAGCTGCAGATGCCTTCCTGGACTTGATCAGGAACATGTTCCCTCCAAATCTGGTAGAAGCCTGCTTTAAACAGTTTAAAACCAACTATGAGAAGAGAAGCTTTAAAGTGCCCATCCAGGCCAACGAAACGCTTGTGGGTGCTGTGATAAACAATGTGTCTGAGGCCATGGAGACTCT

Ensembl | nº de acceso humano

ENSG00000079215

Nº de acceso NCBI

NM_004172

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC1A3(6507) , SLC1A3(6507)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZAV

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hirofumi Nagao et al.
The Journal of biological chemistry, 292(11), 4469-4483 (2017-01-26)
Obesity is closely associated with various metabolic disorders. However, little is known about abnormalities in the metabolic change of obese adipose tissue. Here we use static metabolic analysis and
Thomas Bertero et al.
Cell metabolism, 29(1), 124-140 (2018-10-09)
Dysregulation of extracellular matrix (ECM) deposition and cellular metabolism promotes tumor aggressiveness by sustaining the activity of key growth, invasion, and survival pathways. Yet mechanisms by which biophysical properties of ECM relate to metabolic processes and tumor progression remain undefined.
Mylène Tajan et al.
Cell metabolism, 28(5), 721-736 (2018-08-21)
Numerous mechanisms to support cells under conditions of transient nutrient starvation have been described. Several functions of the tumor-suppressor protein p53 can contribute to the adaptation of cells to metabolic stress and help cancer cell survival under nutrient-limiting conditions. We

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico